Cover Image

Clonning and characterization of alfa-globulin promoter into an expression vector

The world population is expected to rise by an addition of 2 billion by 2030 and rice consumers are projected to increase by 1.8% annually. Hence, rice production must be increased between 25-45% to match-up the growing population since it is a staple food to more than half of the world’s population...

Full description

Saved in:
Bibliographic Details
Main Author: Mustafa, Abubakar Sadik
Format: Thesis
Language:English
Published: 2013
Subjects:
QK Botany
Online Access:http://eprints.utm.my/id/eprint/36733/1/AbubakarSadikMustafaMFBSK2013.pdf
http://eprints.utm.my/id/eprint/36733/
Tags: Add Tag
No Tags, Be the first to tag this record!
id my.utm.36733
record_format eprints
spelling my.utm.367332017-09-14T04:23:02Z http://eprints.utm.my/id/eprint/36733/ Clonning and characterization of alfa-globulin promoter into an expression vector Mustafa, Abubakar Sadik QK Botany The world population is expected to rise by an addition of 2 billion by 2030 and rice consumers are projected to increase by 1.8% annually. Hence, rice production must be increased between 25-45% to match-up the growing population since it is a staple food to more than half of the world’s population. The manipulation of targeted gene in endosperm is a reliable tissue for the production of recombinant proteins over other tissues because it is more cost-effective, it is easier to scale-up agricultural yield, provides a larger storage ability and safe long-term storage. However only a few endosperm-specific promoters have been identified. The present research, successfully constructed the recombinant plasmid, pCAMGpro from the expression vector, pCAMBIA1305.2 containing the strong endosperm-specific a-globulin promoter (AsGpro). The AsGpro was successfully amplified from pmCACA:GFP using the forward primer, AsGproF_HindIII (5' CACAAACGTGCAAAAGCTTAATTCG 3') and the reverse primer, AsGproR_BamHI (5' GACGGATCCGAGATTGTAGAAGG 3') at 55°C. The size of the promoter fragment was approximately 848 bp. Sequencing and subsequent bioinformatics analysis, confirmed 98% homology of nucleotides to A. sativa (Glo1) gene, promoter region (Accession number: AY795082.1). This fragment was then cloned into pMR104a to generate the recombinant plasmid pMRGpro. Subsequent cloning of the recombinant cassette into the expression vector, pCAMBIA1305.2 to create the new recombinant plasmid, pCAMGpro was achieved. These finding can be used to genetically modify rice to express high levels of endosperm specific nutritional proteins of interest that would increase food production and help in alleviating the food crisis facing the world. 2013-01 Thesis NonPeerReviewed application/pdf en http://eprints.utm.my/id/eprint/36733/1/AbubakarSadikMustafaMFBSK2013.pdf Mustafa, Abubakar Sadik (2013) Clonning and characterization of alfa-globulin promoter into an expression vector. Masters thesis, Universiti Teknologi Malaysia, Faculty of Biosciences and Medical Engineering.
institution Universiti Teknologi Malaysia
building UTM Library
collection Institutional Repository
continent Asia
country Malaysia
content_provider Universiti Teknologi Malaysia
content_source UTM Institutional Repository
url_provider http://eprints.utm.my/
language English
topic QK Botany
spellingShingle QK Botany
Mustafa, Abubakar Sadik
Clonning and characterization of alfa-globulin promoter into an expression vector
description The world population is expected to rise by an addition of 2 billion by 2030 and rice consumers are projected to increase by 1.8% annually. Hence, rice production must be increased between 25-45% to match-up the growing population since it is a staple food to more than half of the world’s population. The manipulation of targeted gene in endosperm is a reliable tissue for the production of recombinant proteins over other tissues because it is more cost-effective, it is easier to scale-up agricultural yield, provides a larger storage ability and safe long-term storage. However only a few endosperm-specific promoters have been identified. The present research, successfully constructed the recombinant plasmid, pCAMGpro from the expression vector, pCAMBIA1305.2 containing the strong endosperm-specific a-globulin promoter (AsGpro). The AsGpro was successfully amplified from pmCACA:GFP using the forward primer, AsGproF_HindIII (5' CACAAACGTGCAAAAGCTTAATTCG 3') and the reverse primer, AsGproR_BamHI (5' GACGGATCCGAGATTGTAGAAGG 3') at 55°C. The size of the promoter fragment was approximately 848 bp. Sequencing and subsequent bioinformatics analysis, confirmed 98% homology of nucleotides to A. sativa (Glo1) gene, promoter region (Accession number: AY795082.1). This fragment was then cloned into pMR104a to generate the recombinant plasmid pMRGpro. Subsequent cloning of the recombinant cassette into the expression vector, pCAMBIA1305.2 to create the new recombinant plasmid, pCAMGpro was achieved. These finding can be used to genetically modify rice to express high levels of endosperm specific nutritional proteins of interest that would increase food production and help in alleviating the food crisis facing the world.
format Thesis
author Mustafa, Abubakar Sadik
author_facet Mustafa, Abubakar Sadik
author_sort Mustafa, Abubakar Sadik
title Clonning and characterization of alfa-globulin promoter into an expression vector
title_short Clonning and characterization of alfa-globulin promoter into an expression vector
title_full Clonning and characterization of alfa-globulin promoter into an expression vector
title_fullStr Clonning and characterization of alfa-globulin promoter into an expression vector
title_full_unstemmed Clonning and characterization of alfa-globulin promoter into an expression vector
title_sort clonning and characterization of alfa-globulin promoter into an expression vector
publishDate 2013
url http://eprints.utm.my/id/eprint/36733/1/AbubakarSadikMustafaMFBSK2013.pdf
http://eprints.utm.my/id/eprint/36733/
_version_ 1643650010241302528
score 13.211869

Similar Items