Cover Image

Construction of a plant transformation vector carrying a marker gene for expression in plants

The construction of plant Iransfonnalion vector, a binary vector is importam especially in plant transfonna tion involving Agrobaclenwn (ume/aciens. The resultaIll binary veClor is transfonne::d into AgJobaCferiflll1 lume!aclens as a carrier to be fun her transformed inla the plants. In this stud y,...

Full description

Saved in:
Bibliographic Details
Main Author: Ngien, Leh Nah.
Format: Final Year Project Report
Language:English
Published: Universiti Malaysia Sarawak (UNIMAS) 2006
Subjects:
QR Microbiology
Online Access:http://ir.unimas.my/id/eprint/19887/3/Ngien%20Leh%20Nah.pdf
http://ir.unimas.my/id/eprint/19887/
Tags: Add Tag
No Tags, Be the first to tag this record!
id my.unimas.ir.19887
record_format eprints
spelling my.unimas.ir.198872024-01-22T01:48:38Z http://ir.unimas.my/id/eprint/19887/ Construction of a plant transformation vector carrying a marker gene for expression in plants Ngien, Leh Nah. QR Microbiology The construction of plant Iransfonnalion vector, a binary vector is importam especially in plant transfonna tion involving Agrobaclenwn (ume/aciens. The resultaIll binary veClor is transfonne::d into AgJobaCferiflll1 lume!aclens as a carrier to be fun her transformed inla the plants. In this stud y, the transferred-DNA or T-DNA (-5.5 kb) originated from binary vector, pBl12l supplied by Arabidopsis Biologic31 Resource Center (Columbus) was PCR-amplified in order to be subcloned into pUCl9 vector. The complete sequence of pBl121 (Accession number: AF485783) was derived and primer designed for amplification of T-DNA and non-T-DNA regions. T-DNA was successfully PCR-amplified by using forward primer (5' -GCATATGTAGGTTTACCCGCCAATATATCCTGTCA -3') and reverse primer (5' -GCATATG AGGCAGGATATATTGTGGTGTAAACA -3'). Several h'ials with different subcloning strategies were carried out to subelone the PCR fi'agment (T-DNA) into pUCI9. The ligation reaction mixture was evemually transfonlled inlo E. coli strain JM 109. Less than 50% of white colonies were obselved by using adaptors wi th BamHI site which were added during ligation together with BamHI-cut pUCJ9. However, the gene cloning was failed as no insert was detected both with restriction enzyme and PCR analyses. The problem was mainly due to fuilure in ligation reaction. The work to form a helper plasmid from PCR-amplified non-T-DNA could not be carried out due to time constraint. Universiti Malaysia Sarawak (UNIMAS) 2006 Final Year Project Report NonPeerReviewed text en http://ir.unimas.my/id/eprint/19887/3/Ngien%20Leh%20Nah.pdf Ngien, Leh Nah. (2006) Construction of a plant transformation vector carrying a marker gene for expression in plants. [Final Year Project Report] (Unpublished)
institution Universiti Malaysia Sarawak
building Centre for Academic Information Services (CAIS)
collection Institutional Repository
continent Asia
country Malaysia
content_provider Universiti Malaysia Sarawak
content_source UNIMAS Institutional Repository
url_provider http://ir.unimas.my/
language English
topic QR Microbiology
spellingShingle QR Microbiology
Ngien, Leh Nah.
Construction of a plant transformation vector carrying a marker gene for expression in plants
description The construction of plant Iransfonnalion vector, a binary vector is importam especially in plant transfonna tion involving Agrobaclenwn (ume/aciens. The resultaIll binary veClor is transfonne::d into AgJobaCferiflll1 lume!aclens as a carrier to be fun her transformed inla the plants. In this stud y, the transferred-DNA or T-DNA (-5.5 kb) originated from binary vector, pBl12l supplied by Arabidopsis Biologic31 Resource Center (Columbus) was PCR-amplified in order to be subcloned into pUCl9 vector. The complete sequence of pBl121 (Accession number: AF485783) was derived and primer designed for amplification of T-DNA and non-T-DNA regions. T-DNA was successfully PCR-amplified by using forward primer (5' -GCATATGTAGGTTTACCCGCCAATATATCCTGTCA -3') and reverse primer (5' -GCATATG AGGCAGGATATATTGTGGTGTAAACA -3'). Several h'ials with different subcloning strategies were carried out to subelone the PCR fi'agment (T-DNA) into pUCI9. The ligation reaction mixture was evemually transfonlled inlo E. coli strain JM 109. Less than 50% of white colonies were obselved by using adaptors wi th BamHI site which were added during ligation together with BamHI-cut pUCJ9. However, the gene cloning was failed as no insert was detected both with restriction enzyme and PCR analyses. The problem was mainly due to fuilure in ligation reaction. The work to form a helper plasmid from PCR-amplified non-T-DNA could not be carried out due to time constraint.
format Final Year Project Report
author Ngien, Leh Nah.
author_facet Ngien, Leh Nah.
author_sort Ngien, Leh Nah.
title Construction of a plant transformation vector carrying a marker gene for expression in plants
title_short Construction of a plant transformation vector carrying a marker gene for expression in plants
title_full Construction of a plant transformation vector carrying a marker gene for expression in plants
title_fullStr Construction of a plant transformation vector carrying a marker gene for expression in plants
title_full_unstemmed Construction of a plant transformation vector carrying a marker gene for expression in plants
title_sort construction of a plant transformation vector carrying a marker gene for expression in plants
publisher Universiti Malaysia Sarawak (UNIMAS)
publishDate 2006
url http://ir.unimas.my/id/eprint/19887/3/Ngien%20Leh%20Nah.pdf
http://ir.unimas.my/id/eprint/19887/
_version_ 1789430288201285632
score 13.211869

Similar Items