Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected...
Saved in:
| Main Authors: | , , , , , , , , , |
|---|---|
| Format: | Article |
| Language: | en |
| Published: |
Karger AG, Basel
2015
|
| Subjects: | |
| Online Access: | http://ir.unimas.my/id/eprint/8402/1/NO%20140%20Transfusion-dependent%20Thalassemia%20in%20northern%20Sarawak%20-%20abstrak.pdf http://ir.unimas.my/id/eprint/8402/ http://www.researchgate.net/publication/268632267_Transfusion-Dependent_Thalassemia_in_Northern_Sarawak_A_Molecular_Study_to_Identify_Different_Genotypes_in_the_Multi-Ethnic_Groups_and_the_Importance_of_Genomic_Sequencing_in_Unstudied_Populations |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| Summary: | Background: Although thalassemia is a genetic hemoglobinopathy
in Malaysia, there is limited data on thalassemia mutations
in the indigenous groups. This study aims to identify
the types of globin gene mutations in transfusion-dependent
patients in Northern Sarawak. Methods: Blood was collected
from 32 patients from the Malay, Chinese, Kedayan, Bisayah,
Kadazandusun, Tagal, and Bugis populations. The α- and
β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2
previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia
alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and
Tagal patients. The β-globin gene mutations in the Chinese
patients were similar to the Chinese in West Malaysia. Hb Adana
(HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected
in 5 patients. A novel 24-bp deletion in the α2-globin gene
(HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG)
was identified by sequencing. Co-inheritance of α-thalassemia
with β-thalassemia did not ameliorate the severity of
thalassemia major in the patients. Conclusion: The Filipino
β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique
to the Malays in Sarawak. Genomic sequencing is an essential
tool to detect rare genetic variants in the study of new populations. |
|---|